Dynamic genomic changes in methotrexate-resistant human cancer cell lines beyond DHFR amplification suggest potential new targets for preventing drug resistance.

BACKGROUND: Although DHFR gene amplification has long been known as a major mechanism for methotrexate (MTX) resistance in cancer, the early changes and detailed development of the resistance are not yet fully understood. METHODS: We performed genomic, transcriptional and proteomic analyses of human colon cancer cells with sequentially increasing levels of MTX-resistance. RESULTS: The genomic amplification evolved in three phases (pre-amplification, homogenously staining region (HSR) and extrachromosomal DNA (ecDNA)). We confirm that genomic amplification and increased expression of DHFR, with formation of HSRs and especially ecDNAs, is the major driver of resistance. However, DHFR did not play a detectable role in the early phase. In the late phase (ecDNA), increase in FAM151B protein level may also have an important role by decreasing sensitivity to MTX. In addition, although MSH3 and ZFYVE16 may be subject to different posttranscriptional regulations and therefore protein expressions are decreased in ecDNA stages compared to HSR stages, they still play important roles in MTX resistance. CONCLUSION: The study provides a detailed evolutionary trajectory of MTX-resistance and identifies new targets, especially ecDNAs, which could help to prevent drug resistance. It also presents a proof-of-principal approach which could be applied to other cancer drug resistance studies.

Effects of long-term closed and socially isolating spaceflight analog environment on default mode network connectivity as indicated by fMRI.

Long-term manned spaceflight and extraterrestrial planet settlement become the focus of space powers. However, the potential influence of closed and socially isolating spaceflight on the brain function remains unclear. A 180-day controlled ecological life support system integrated experiment was conducted, establishing a spaceflight analog environment to explore the effect of long-term socially isolating living. Three crewmembers were enrolled and underwent resting-state fMRI scanning before and after the experiment. We performed both seed-based and network-based analyses to investigate the functional connectivity (FC) changes of the default mode network (DMN), considering its key role in multiple higher-order cognitive functions. Compared with normal controls, the leader of crewmembers exhibited significantly reduced within-DMN and between-DMN FC after the experiment, while two others exhibited opposite trends. Moreover, individual differences of FC changes were further supported by evidence from behavioral analyses. The findings may shed new light on the development of psychological protection for space exploration.

Urban-canopy airflow dynamics: A numerical investigation of drag forces and distribution for generic neighborhoods, and their relationships with breathability.

Thorough investigations of urban-canopy drag primarily stemming from pressure drag on building surfaces are necessary given the turbulent flows within complex urban areas. Moreover, a gap persists regarding the relationships between canopy drag and breathability. Therefore, this work delves into the canopy-layer airflow dynamics for generic urban neighborhoods by performing three-dimensional Reynolds-Averaged Navier-Stokes simulations. A total of 32 subcases are examined, encompassing uniform- and varying-height and diverse plan area densities (λp, categorized into groups of sparse: 0.0625/0.067, medium: 0.23/0.25, and dense: 0.53/0.56). Results for the drag distribution highlight the windward-row shelter effect for the medium and the dense, local shelter by taller buildings, and distinct shapes of sectional drag forces (F⁎Z). Local velocity and mean age of air are found strongly positively and negatively correlated to F⁎Z, respectively, with distinct slopes in relation to λp. For the uniform-height, the normalized bulk drag (F⁎bulk, referred to as drag coefficient in literature) peaks for the medium with wake-interference regime; F⁎bulk demonstrates a maximum increase of over two times with height variation; moreover, F⁎bulk for varying-height groups exhibits a marked increase from the sparse to the medium, while remaining comparable values for the dense. The frontal area averaged drag (FAf,ave) exhibits a decreasing trend against λp across all cases. Further, FAf,ave exhibits strong correlations with λp and porosity, and with bulk ventilation indices such as spatially averaged velocity, air change rate, and normalized net escape velocity. Throughout the 'suburban-urban-suburban' canopy, medium neighborhoods exerting larger drag cause greater streamwise outdoor pressure drops and flow reductions compared to the sparse. However, dense neighborhoods with lower drag exhibit even larger pressure losses, which should be carefully scrutinized. The findings can inform urban planners in designing more aerodynamically efficient neighborhoods and guide strategies for improving air quality within urban environments.

RPL22L1, a novel candidate oncogene promotes temozolomide resistance by activating STAT3 in glioblastoma.

Aggressiveness and drug resistance are major challenges in the clinical treatment of glioblastoma (GBM). Our previously research reported a novel candidate oncogene ribosomal protein L22 like 1 (RPL22L1). The aim of this study was to elucidate the potential role and mechanism of RPL22L1 in progression and temozolomide (TMZ) resistance of GBM. Online database, tissue microarrays and clinical tissue specimens were used to evaluate the expression and clinical implication of RPL22L1 in GBM. We performed cell function assays, orthotopic and subcutaneous xenograft tumor models to evaluate the effects and molecular mechanisms of RPL22L1 on GBM. RPL22L1 expression was significantly upregulated in GBM and associated with poorer prognosis. RPL22L1 overexpression enhanced GBM cell proliferation, migration, invasion, TMZ resistance and tumorigenicity, which could be reduced by RPL22L1 knockdown. Further, we found RPL22L1 promoted mesenchymal phenotype of GBM and the impact of these effects was closely related to EGFR/STAT3 pathway. Importantly, we observed that STAT3 specific inhibitor (Stattic) significantly inhibited the malignant functions of RPL22L1, especially on TMZ resistance. RPL22L1 overexpressed increased combination drug sensitive of Stattic and TMZ both in vitro and in vivo. Moreover, Stattic effectively restored the sensitive of RPL22L1 induced TMZ resistance in vitro and in vivo. Our study identified a novel candidate oncogene RPL22L1 which promoted the GBM malignancy through STAT3 pathway. And we highlighted that Stattic combined with TMZ therapy might be an effective treatment strategy in RPL22L1 high-expressed GBM patients.

Novel insights into the ecDNA formation mechanism involving MSH3 in methotrexate­resistant human colorectal cancer cells.

Extrachromosomal DNAs (ecDNAs), also known as double minutes (DMs), can induce a fast increase in gene copy numbers and promote the development of cancer, including drug resistance. MutS homolog 3 (MSH3), a key protein in mismatch repair, has been indicated to participate in the regulation of DNA double­strand break (DSB) repair, which has been reported to be associated with the formation of ecDNAs. However, it remains unclear whether MSH3 can influence drug resistance via ecDNAs in cancer. In the present study, high MSH3 expression was observed in methotrexate (MTX)­resistant HT29 cells [DM­ and homogeneously staining region (HSR)­containing cells] compared with parental HT29 cells. Additionally, decreased amounts of ecDNAs, HSRs and amplified genes locating on ecDNAs and HSRs were detected following depletion of MSH3 and this could be reversed by overexpressing MSH3 in DM­containing cells. No corresponding changes were found in HSR­containing cells. The present study further verified the involvement of MSH3­regulated DNA DSB repair pathways in the formation of ecDNAs by detecting the expression of core proteins and pathway activity. Furthermore, expulsion of ecDNAs/HSRs was detected and increased frequencies of micronuclei/nuclear buds with dihydrofolate reductase (DHFR) signals were observed in MSH3­depleted DM­containing cells. Finally, changes in MSH3 expression could affect DHFR amplification­derived DHFR expression and cell sensitivity to MTX, suggesting that MSH3 may influence cancer drug resistance by altering the amount of ecDNAs. In conclusion, the present study revealed a novel mechanism involving MSH3 in the regulation of ecDNAs by DSB repair, which will have clinical value in the treatment of ecDNA­based drug resistance in cancer.

The effect of SNPs in lncRNA as ceRNA on the risk and prognosis of hepatocellular carcinoma.

BACKGROUND: Most susceptible loci of hepatocellular carcinoma (HCC) identified by genome-wide association studies (GWAS) are located in non-coding regions, and the mechanism of action remains unclear. The objective of this study was to explore the association of single nucleotide polymorphisms (SNPs) on long non-coding RNAs (lncRNAs) that affect competing endogenous RNAs (ceRNA) regulation mechanism with the risk and prognosis of HCC. METHODS: Based on a set of bioinformatics strategies, eight lncRNA genes that affect HCC through the mechanism of lncRNA-mediated ceRNA were systematically screened, and 15 SNPs that affect microRNA (miRNA) binding in these lncRNA genes were annotated. Genotyping was performed in 800 HCC cases and 801 healthy controls to examine associations of these SNPs with HCC in a northeastern Chinese Han population. RESULTS: The GG, GC and GG + GC genotypes of HOTAIR rs7958904 were associated with a 0.65, 0.59 and 0.63-fold decreased HCC risk, respectively. In addition, HCC patients with PVT1 rs3931282 AA + GA genotypes were less prone to develop late-stage cancers in a stratified analysis of clinical characteristics. When stratified by clinical biochemical indexes, rs1134492 and rs10589312 in PVT1 and rs84557 in EGFR-AS1 showed significant associations with aspartate aminotransferase (AST), alanine aminotransferase (ALT) or AST/ALT ratio in HCC patients. Furthermore, we constructed potential ceRNA regulatory axes that might be affected by five positive SNPs to explain the causes of these genetic associations. CONCLUSIONS: HOTAIR rs7958904, PVT1 rs3931282, rs1134492 and rs10589312, and EGFR-AS1 rs84557 might be predictors for HCC risk or prognosis. Our results provide new insights into how SNPs on lncRNA-mediated ceRNAs confer interindividual differences to occurrence and progression of HCC.

Assessment of the Driving Pollution Factors of Soil Environmental Quality Based on China's Risk Control Standard: Multiple Bigdata-Based Approaches with Intensive Sampling.

Identifying the driving factors of soil environmental quality is critical in raising countermeasures for managing the soil environment efficiently and precisely. In 2018, China issued risk control standards to divide soil environmental quality into three classes to meet the demands of environment management. However, there is a lack of knowledge of this new standard. An intensive field-sampling research (2598 top-soil samples were analyzed) was conducted in the agricultural land of Hubei province, central China, to find the driving factors of pollutants based on this new standard. According to the standard, the proportion of classes 1, 2, and 3 in the overall quality grade was 57.3%, 41.7%, and 1%, respectively. The standardized index showed that the pollution levels of cadmium, arsenic, lead, and chromium were higher than that of mercury. The first component of the principal component analysis explained 56.4% of the total variance, and the loading of cadmium, arsenic and lead were -53.5%, -52.1%, and -51.2%, respectively. The general linear modeling found that cadmium and arsenic showed positive and significant effects (p < 0.001) on the grading results of soil environmental quality. Based on the random forest algorithm, cadmium showed the greatest importance on soil environmental quality (increase in mean squared error = 32.5%). Overall, this study revealed that cadmium, arsenic, and lead were driving pollutants affecting soil environment quality grade. The large data size increased the reliability and robustness of the study's conclusions, and it provided reference methods for future studies investigating China's new standard for assessing soil environmental quality.

Ribosomal protein L22-like1 (RPL22L1) mediates sorafenib sensitivity via ERK in hepatocellular carcinoma.

Precision medicine in hepatocellular carcinoma (HCC) relies on validated biomarkers that help subgroup patients for targeted treatment. Here, we identified a novel candidate oncogene, ribosomal protein L22-like1 (RPL22L1), which was markedly elevated in HCC, contributed to HCC malignancy and adverse patient survival. Functional studies indicated RPL22L1 overexpression accelerated cell proliferation, migration, invasion and sorafenib resistance. Mechanism studies revealed that RPL22L1 activated ERK to induce atypical epithelial-to-mesenchymal transition (EMT) progress. Importantly, the ERK inhibitor (ERKi) could potentiate sorafenib efficiency in RPL22L1-high HCC cells. In summary, these data uncover RPL22L1 is a potential marker to guide precision therapy for utilizing ERKi to enhance the sorafenib efficacy in RPL22L1-high HCC patients.

Prediction Performance Comparison of Risk Management and Control Mode in Regional Sites Based on Decision Tree and Neural Network.

The traditional risk management and control mode (RMCM) in regional sites has the defects of low efficiency, high cost, and lack of systematism. Trying to resolve these defects and explore the application possibility of machine learning, a characteristic dataset for RMCM in regional sites was established. Three decision tree (DT) algorithms (CHAID, EXHAUSTIVE CHAID, and CART) and two artificial neural network (ANN) algorithms [back propagation (BP) and radial basis function (RBF)] were implemented to predict RMCM in regional sites. The results showed that in the aspects of accuracy (ACC), precision (PRE), recall ratio (REC), and F1 value, CART-DT was superior to CHAID-DT and EXHAUSTIVE CHAID-DT (E-CHAID-DT); and BP-ANN was superior to RBF-ANN. However, CART-DT was inferior to BP-ANN in ACC, PRE, REC, and F1 value. BP-ANN model is good at non-linear mapping, and it has a flexible network structure and a low risk of over-fitting. The case study of a typical county demonstration area confirmed the extensibility of the method, and the method has great potential in RMCM prediction in regional sites in the future.

The mitochondrial proteomic changes of rat hippocampus induced by 28-day simulated microgravity.

A large number of aerospace practices have confirmed that the aerospace microgravity environment can lead to cognitive function decline. Mitochondria are the most important energy metabolism organelles, and some studies demonstrate that the areospace microgravity environment can cause mitochondrial dysfunction. However, the relationships between cognitive function decline and mitochondrial dysfunction in the microgravity environment have not been elucidated. In this study, we simulated the microgravity environment in the Sprague-Dawley (SD) rats by -30° tail suspension for 28 days. We then investigated the changes of mitochondrial morphology and proteomics in the hippocampus. The electron microscopy results showed that the 28-day tail suspension increased the mitochondria number and size of rat hippocampal neuronal soma. Using TMT-based proteomics analysis, we identified 163 differentially expressed proteins (DEPs) between tail suspension and control samples, and among them, 128 proteins were upregulated and 35 proteins were downregulated. Functional and network analyses of the DEPs indicated that several of mitochondrial metabolic processes including the tricarboxylic acid (TCA) cycle were altered by simulating microgravity (SM). We verified 3 upregulated proteins, aconitate hydratase (ACO2), dihydrolipoamide S-succinyltransferase (DLST), and citrate synthase (CS), in the TCA cycle process by western blotting and confirmed their differential expressions between tail suspension and control samples. Taken together, our results demonstrate that 28-day tail suspension can cause changes in the morphology and metabolic function of hippocampus mitochondria, which might represent a mechanism of cognitive disorder caused by aerospace microgravity.

The Impacts of Non-coding RNAs and N6-Methyladenosine on Cancer: Past, Present and Future.

N6-methyladenosine (m6A) modifications control multifaceted RNA metabolism and are one of the most extensively distributed modifications on the human transcriptome, including non-coding RNAs (ncRNAs). Previous concepts of ncRNAs as "junk" transcriptional products have evolved to the concept that ncRNAs are functional regulatory molecules that determine specific biological processes and cell fates. The dysregulation of m6A modifications and ncRNAs have been implicated in the development of human carcinogenesis. Certain types of ncRNAs have been reported to exert regulatory effects on m6A machinery. However, a better understanding of the relationship between m6A modifications and ncRNAs in cancer is still needed. This review discusses mutual interactions between m6A modifications and ncRNAs and their impacts on the development of human cancer. We summarize the clinical significance of m6A-ncRNA networks for cancer diagnosis and treatment, and we ask challenging questions that remain unanswered in this field of research. Understanding the complex coordination between m6A modifications and ncRNAs will be useful for guiding the development of therapeutic interventions.

Molecular structure and evolution mechanism of two populations of double minutes in human colorectal cancer cells.

Gene amplification chiefly manifests as homogeneously stained regions (HSRs) or double minutes (DMs) in cytogenetically and extrachromosomal DNA (ecDNA) in molecular genetics. Evidence suggests that gene amplification is becoming a hotspot for cancer research, which may be a new treatment strategy for cancer. DMs usually carry oncogenes or chemoresistant genes that are associated with cancer progression, occurrence and prognosis. Defining the molecular structure of DMs will facilitate understanding of the molecular mechanism of tumorigenesis. In this study, we re-identified the origin and integral sequence of DMs in human colorectal adenocarcinoma cell line NCI-H716 by genetic mapping and sequencing strategy, employing high-resolution array-based comparative genomic hybridization, high-throughput sequencing, multiplex-fluorescence in situ hybridization and chromosome walking techniques. We identified two distinct populations of DMs in NCI-H716, confirming their heterogeneity in cancer cells, and managed to construct their molecular structure, which were not investigated before. Research evidence of amplicons distribution in two different populations of DMs suggested that a multi-step evolutionary model could fit the module of DM genesis better in NCI-H716 cell line. In conclusion, our data implicated that DMs play a very important role in cancer progression and further investigation is necessary to uncover the role of the DMs.

Disease causing property analyzation of variants in 12 Chinese families with polycystic kidney disease.

BACKGROUND: Polycystic kidney disease (PKD) is an inherited disease that is life-threatening. Multiple cysts are present in the bilateral kidneys of PKD patients. The progressively enlarged cysts cause structural damage and loss of kidney function. METHODS: This study examined and analyzed 12 families with polycystic kidney disease. Whole exome sequencing (WES) or whole genome sequencing (WGS) of the probands was performed to detect the pathogenic genes. The candidate gene segments for lineal consanguinity in the family were amplified by the nest PCR followed by Sanger sequencing. The variants were assessed by pathogenic and conservational property prediction analysis and interpreted according to the American College of Medical Genetics and Genomics. RESULTS: Nine of the 12 pedigrees were identified the disease causing variants. Among them, four novel variants in PKD1, c.6930delG:p.C2311Vfs*3, c.1216T>C:p.C406R, c.8548T>C:p.S2850P, and c.3865G>A:p.V1289M (NM_001009944.2) were detected. After assessment, the four novel variants were considered to be pathogenic variants and cause autosomal dominant polycystic kidney disease in family. The detected variants were interpreted. CONCLUSION: The four novel variants in PKD1, c.6930delG:p.C2311Vfs*3, c.1216T>C:p.C406R, c.8548T>C:p.S2850P, and c.3865G>A:p.V1289M (NM_001009944.2) are pathogenic variants and cause autosomal dominant polycystic kidney disease in family.

Physiological Acclimatization of the Liver to 180-Day Isolation and the Mars Solar Day.

Physiological changes in humans are evident under environmental conditions similar to those on a Mars mission involving both a space factor (long-term isolation) and a time factor (the Mars solar day). However, very few studies have investigated the response of the liver to those conditions. Serum protein levels, bilirubin levels, aminotransferase activities, blood alkaline phosphatase, gamma-glutamyltransferase, lipid levels, and serum cytokines interleukin-6 and interferon-γ levels were analyzed 30 days before the mock mission; on days 2, 30, 60, 75, 90, 105, 120, 150, and 175 of the mission; and 30 days after the mission, in four subjects in 4-person 180-day Controlled Ecological Life Support System Experiment. Serum protein levels (total protein and globulin) decreased and bilirubin increased under the isolation environment from day 2 and exhibited chronic acclimatization from days 30 to 175. Effects of the Mars solar day were evident on day 75. Blood lipid levels were somewhat affected. No obvious peak in any enzyme level was detected during the mission. The change tendency of these results indicated that future studies should explore whether protein parameters especially globulin could serve as indicators of immunological function exposure to the stress of a Mars mission.

Analysis of miRNA expression profiles in the liver of Clock Δ19 mutant mice.

The circadian clock controls the physiological functions of many tissues including the liver via an autoregulatory transcriptional-translational feedback loop, of which CLOCK is a core positive component. In addition, many studies have indicated that microRNAs (miRNAs) regulate liver function. However, how CLOCK-regulated miRNAs are linked to liver function remains largely unknown. In this study, miRNAs expression profiles were performed in the liver of Clock Δ19 mutant mice. Compared to wild type mice, totals of 61 and 57 putative CLOCK-regulated miRNAs were differentially expressed (fold change absolute value ≥2) at zeitgeber time 2 and zeitgeber time 14, respectively. According to the pathway analyses, the target genes of differentially expressed miRNAs were mainly involved in pathways in cancer, the PI3K-Akt signaling pathway and the MAPK signaling pathway. Protein-protein interaction analyses revealed that the hub genes were primarily associated with pathway in cancer and circadian rhythms. Expression validation showed that while the expression levels of miR-195 and miR-340 were up-regulated, the rhythms of these two miRNAs were always maintained. The expression level of nr1d2 mRNA was down-regulated. We identified a number of prospective CLOCK-regulated miRNAs that play roles in the various physiological processes of the liver, providing a reference to better understanding the potential regulatory mechanisms in the liver.

A heterozygous duplication variant of the HOXD13 gene caused synpolydactyly type 1 with variable expressivity in a Chinese family.

BACKGROUND: Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family. METHODS: We used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines. RESULTS: Our results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family. CONCLUSION: Based on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.

Hydrogen peroxide modulates clock gene expression via PRX2-STAT3-REV-ERBα/ß pathway.

The circadian rhythm is a widespread physiological phenomenon present in almost all forms of life and is constituted by a system of interlocked transcriptional/translational feedback loops (TTFLs). External zeitgebers regulate biological rhythms through the direct or indirect regulation of circadian genes. Oxidative stress is involved in many diseases and injuries, such as ageing, diabetes, Alzheimer's disease, and cancer. Despite an increasing number of studies on circadian rhythm disorders caused by oxidative stress, little is known about the effects of oxidants on clock gene expression and the underlying mechanism. In this study, we found that the protein expression of circadian genes Clock, Bmal1, Per1/2, and Cry1/2 in NIH3T3 cells was upregulated by hydrogen peroxide (H2O2), an important mediator of oxidative stress. In addition, H2O2 modulated the circadian rhythm of Bmal1-luciferase via RORα, REV-ERBα (NR1D1), and REV-ERBß (NR1D2). Further studies showed that H2O2 regulated biological rhythm by PRX2-STAT3-REV-ERBα/ß pathway. These findings provide an accessory loop-related mechanism by which non-transcriptional oscillation interplays with TTFLs.

TSPAN12 Precedes Tumor Proliferation by Cell Cycle Control in Ovarian Cancer.

TSPAN12, a member of the tetraspanin family, has been highly connected with the pathogenesis of cancer. Its biological function, however, especially in ovarian cancer (OC), has not been well elucidated. In this study, The Cancer Genome Atlas (TCGA) dataset analysis revealed that upregulation of TSPAN12 gene expression was significantly correlated with patient survival, suggesting that TSPAN12 might be a potential prognostic marker for OC. Further exploration showed that TSPAN12 overexpression accelerated proliferation and colony formation of OVCAR3 and SKOV3 OC cells. Knockdown of TSPAN12 expression in A2780 and SKOV3 cells decreased both proliferation and colony formation. Western blot analysis showed that several cyclins and cyclin-dependent kinases (CDK) (e.g., Cyclin A2, Cyclin D1, Cyclin E2, CDK2, and CDK4) were significantly involved in the regulation of cell cycle downstream of TSPAN12. Moreover, TSPAN12 accelerated mitotic progression by controlling cell cycle. Thus, our data demonstrated that TSPAN12 could be a novel molecular target for the treatment of OC.

Identification of a pathogenic mutation in a Chinese pedigree with polycystic kidney disease.

Polycystic kidney disease (PKD) is a life­threatening inherited disease with a morbidity of 1:500­1,000 worldwide. Numerous progressively enlarging cysts are observed in the bilateral kidneys of patients with PKD, inducing structural damage and loss of kidney function. The present study analyzed one family with PKD. Whole exome sequencing of the proband was performed to detect the pathogenic gene present in the family. Candidate gene segments for lineal consanguinity in the family were amplified by nest polymerase chain reaction, followed by Sanger sequencing. One novel duplication variant (NM_001009944.2:c.9359dupA:p.Y3120_E3121delinsX) and one missense mutation (c.G9022A:p.V3008M) were detected in PKD1. Additionally, the pathogenic substitutions in PKD1 published from the dataset were analyzed. Following analysis and confirmation, the duplication variant NM_001009944.2:c.9359dupA:p.Y3120_E3121delinsX in PKD1, within the polycystin­1, lipoxygenase, α­toxin domain, was considered to be the pathogenic factor in the examined family with autosomal dominant PKD. Additionally, based on the analysis of 4,805 pathogenic substitutions in PKD1 within various regions, the presence of the missense mutation in the N­terminal domain of polycystin­1 may present high pathogenicity in ADPKD.